Abstract

Objectives

The present study aimed to assess the antiproliferative and pro-apoptotic effects of hinokitiol in osteosarcoma cells via in vitro and in silico targeting of glycogen synthase kinase 3β (GSK3β).

Materials and Methods

The (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay was used to evaluate the cytotoxic potential of hinokitiol in osteosarcoma cells. Various concentrations of hinokitiol (5, 10, 20, 40, 60, and 80 µg/mL) were tested, and the half-maximal inhibitory concentration (IC₅₀) was calculated. Cell morphology, migration (scratch assay), and gene expression analysis using real-time polymerase chain reaction for pro-apoptotic studies were conducted, with the IC₅₀ dose of hinokitiol utilized in all these experiments. Additionally the anti-proliferative effect of hinokitiol on GSK3β was also examined using in silico and gene expression methods.

Results

Hinokitiol significantly (p < 0.05) and dose-dependently decreased the viability of MG-63 cells, with an IC₅₀ value of 40 µg/mL. Cell morphology study revealed cellular shrinkage and reduced cell density. The scratch assay revealed anti-migratory activity, while gene expression studies indicated pro-apoptotic effects, including significant (p < 0.05) upregulation of BAX and down-regulation of BCL-2 and GSK3β. Bonding interactions were also observed with GSK3β and atomic contact energy of -5.69 kcal/mol.

Conclusion

According to the current study findings, hinokitiol prevented Morphological study of the effects of hinokitiol on osteosarcoma cells from proliferating, migrating, and induced apoptosis by upregulating BAX (a pro-apoptotic signal) expression and downregulating BCL-2 (anti-apoptotic signal) expression in osteosarcoma cells. In silico findings of hinokitiol showed a significant bonding interaction with GSK3β and its downregulated gene expression probably prevented cancer cell survival.

Keywords:

Hinokitiol, osteosarcoma, MTT assay, in silico, glycogen synthase kinase 3β

INTRODUCTION

Osteosarcoma is a rare malignant condition and is the most prevalent bone cancer. Osteosarcoma primarily affects youths and adolescents.¹ The treatment of osteosarcoma has advanced significantly in the modern era. The treatment includes radiation, chemotherapy, and even surgery. Currently, individuals with osteosarcoma have a 5-year survival rate of approximately 60-70%. Ifosfamide and methotrexate are some of the chemotherapy drugs used. Various combinations and other cytotoxic substances like etoposide have also been proposed in the literature.²However, taking these medications can cause several difficulties and adverse effects, such as neutropenia, mouth fissures, exhaustion, severe diarrhea, nausea, and emesis. The most notorious culprit may be anthracyclines, which cause acute reactions such as chest pain and dyspnea, underscoring a significant drawback of chemotherapy.³ Chemoresistance is another issue posed by contemporary therapies. These therapeutic limitations have inspired researchers to explore new avenues, such as finding new targets and understanding their mechanisms, to identify cutting-edge treatments for a variety of cancers, including osteosarcoma. The most popular cell lines for osteosarcoma are MG-63 cells, which were generated from young Caucasian patients and were derived from their fibroblastic or epithelial origins. MG-63 cells have a highly proliferative phenotype.⁴ The intent of using this specific cell line was to improve its affordability and accessibility as well as be beneficial for experimental research.

Glycogen synthase kinase 3β (GSK3β) is an important protein kinase that regulates metabolism, apoptosis, inflammation, and cell differentiation.^5-7 Aberrant activation of GSK3β has been observed in neurodegenerative diseases, cardiovascular diseases, and some oncological conditions.^{8, 9} Osteosarcomas express more GSK3β than normal cells and tissues. According to several recent studies down-regulated GSK3β may inhibit cancer cell growth and trigger apoptosis in human osteosarcoma cells.^{10, 11} The enhancement of Wnt signaling and catenin signaling through the inhibition of GSK3β is also believed to limit osteosarcoma cancer cell survival and proliferation. Based on these findings, increased expression of GSK3β in cancer is a potential therapeutic target.

Hinokitiol, chemically known as 2-hydroxy-4-isopropylcyclohepta-2,4,6-trien-1-one, (Figure 1), belongs to the monoterpenoid class and has a range of medicinal properties, including neuroprotective,¹² anti-tyronase,¹³ anti-inflammatory¹⁴and anti-proliferative.¹⁵Hinokitinol has been demonstrated in recent studies to be effective against lung adenocarcinoma,¹⁶ melanoma,¹⁷ and breast cancer¹⁸ cell lines. It also interferes with signaling pathways and explains how protein expression stops cancer cells from proliferating, migrating, and metastasizing. The effectiveness of hinokitiol against various cancers has been studied in vitro, and its benefits for bone loss have been evaluated; however, its potential against bone cancer remains unexplored. In this study, its efficacy against osteosarcoma was evaluated to assess the anti-proliferative and pro-apoptotic effects of hinokitiol in osteosarcoma cells via in vitro and in silico targeting of GSK3β.

MATERIALS AND METHODS

Hinokitiol was purchased from the Tokyo Chemical Industry to ensure material purity. The melting point of 51 °C and λmax (238, 320) were assessed using a melting point apparatus and ultraviolet absorption spectroscopy (Shimadzu 160 A) and found the same.

Cell line maintenance

From NCCS in Pune, MG-63 cells were purchased. The cells were grown in T25 culture flasks containing 10% fetal bovine serum (FBS) and 1% anti-biotics in Dulbecco’s modified Eagle medium. Cells were housed in a humidified atmosphere with 5% CO₂ at 37 °C. Once confluence was reached, the cells were trypsinized and passaged.

Cell viability [(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)] assay

Cytotoxicity (loss of viable cells) was assessed using the MTTassay.¹⁹ This assay relies on the metabolic conversion of the soluble MTT salt, 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide, which symbolizes the normal function of mitochondrial dehydrogenase activity and cell viability, into an insoluble colored formazan product, which was estimated spectrophotometrically. The number of viable cells can be directly and proportionally estimated from the activity of mitochondria in living cells. MG-63 cells of 5X10³density per well were coated on 96-well plates, and to this medium FBS was added and kept for 24 h in an incubator. The cells were then exposed to various doses of hinokitiol in triplicate (5, 10, 20, 40, 60, 80 µg/mL) at 5% CO₂ at 37 °C for 24 h. Subsequently, cells were added with MTT reagent and incubated for 4 h (Sigma, MO, USA). The same amount of time was also spent incubating untreated [dimethyl sulfoxide (DMSO)] cells. MTT solubilization solution (Sigma) was used to dissolve the formazan crystals after the incubation period; the formed formazan crystals were then made into a solution in DMSO (100 µl) and incubated in the dark for an hour. A 96-well image reader was used to detect absorbance at 570 nm. The percentage of viable cells was defined as the percentage of control cells established in a serum-free medium. The control medium without treatment was considered 100% viable. The cell viability was calculated using the following formula: % cell viability = [A570 nm of treated cells/A570 nm of control cells] x 100.

Cell morphology analysis

Based on the results of the MTT experiment, we selected the optimum dose (IC₅₀40 µg/mL) for further research. Using a phase-contrast microscope, changes in cell morphology were analyzed. In a 6-well plate, MG63 cells were seeded at a density of 2 x 10⁵ and were kept overnight. The cells were treated with an optimal dose of hinokitiol (40 µg/mL) for 24 h, and untreated cells served as the negative control. When the incubation period ceased, the medium was removed, and the cells were washed with phosphate buffer saline (pH 7.4) and examined under a phase-contrast microscope.

Cell migration was analyzed using the scratch-wound healing assay

MG63 cell line was planted onto a six-well culture plate at a density of 2 x 10⁵ and was kept overnight. The incubated cells were then washed with Dulbecco’s phosphate-buffered saline (DPBS), and a sterile micropipette tip of 200 µl, was used to make a scratch.²⁰ The detached cells and other cellular debris were washed with DPBS. The cells were then treated with an optimal dose of hinokitiol (40 µg/mL) for 24 h, and untreated cells served as the negative control. After incubation, the wells were washed and fixed in 4% paraformaldehyde. Photographs were taken using an inverted microscope (Euromex, The Netherlands).

RNA extraction and gene expression by real-time polymerase chain reaction (RT-PCR)

Using RT-PCR, the gene expression of pro-apoptotic and anti-apoptotic cells was examined, and Trizol Reagent (Sigma) was used to separate the total RNA. Briefly, 1-2 µg of total RNA was transformed to cDNA using, PrimeScript, 1^st strand cDNA synthesis kit (Takara, Japan) by the manufacturer’s instructions.²¹ Primers were designed to specifically amplify targeted genes. The primer sequences BAX-Forward: 5’gctggacattggacttcctc3’; reverse: 5’ctcagcccatcttcttccag3’; BCL-2- forward: 5’gctggacattggacttcctc3’; reverse: 5’ctcagcccatcttcttccag3’. GAPDH- Forward: 5’cgaccactttgtcaagctca3’; reverse: 5’ cccctcttcaaggggtctac3’. GSK3β- Forward: 5’ccgactaacaccactggaagct3’ Reverse: 5’aggatggtagccagaggtggat3’. PCR was performed using iTaq Universal SYBR Green Supermix (Bio-Rad, USA), which contains SYBR green dye and all PCR components.²² Stratagene’s MX3000p PCR machine was used to perform real-time PCR. The results were analyzed using the comparative computed tomography method and 2^−∆∆C_T and the Schmittgen and Livak 2CT method was utilized to calculate fold changes.

Molecular docking

Structure preparation

The crystal structure of GSK3β was downloaded from the Protein Data Bank (PDB) at (PDB http://www.pdb.org/pdb/home/home CODE: 2O5K). The 3D structure of hinokitiol was downloaded from the Pubchem database for docking.

Molecular docking

Auto Dock 4.2 was used to perform docking calculations. Auto Dock Tools (ADT) were used to create grid boxes and .pdbqt files to generate proteins and ligands. ADT was used to modify the native GSK3β structure by adding polar hydrogens, unified Kollman charges, solvation parameters, and fragmental volumes. The Auto Grid was used to construct grid maps representing proteins throughout the docking process. The dimensions of the x, y, and z axes were set to 100, 100, and 100, respectively, and the grid spacing was set to 0.403. The 100 docking conformers were performed using the Lamarckian Genetic Algorithm (LGA), and the Auto Dock application was run with the following parameters; Maximum number of energy evaluations allowed is 250000; GA crossover mode is two points; GA population size is 150. Out of 100 LGA conformers, the conformer with the lowest binding energy was chosen for further analysis. We measured the binding energy and determined both particular and non-specific interaction residues of the entire molecule coupled to GSK3β. The software packages Pymol and Discovery Studio were used to visualize the docked conformations.

Statistical analysis

Data obtained from the study (Cell Viability and Gene expression) were analyzed by One-Way analysis of variance followed by Student’s t-test using SPSS version 20 and represented as mean ± standard deviation for triplicate analyses. Statistical significance was determined at a level of p < 0.05.

RESULTS

Hinokitiol significantly reduces MG-63 cell viability

Cellular survival following exposure to hinokitiol at various concentrations (5, 10, 20, 40, 60, and 80 µg/mL) was determined using absorbance readings obtained from the MTT assay. Results were compared with the corresponding negative controls (untreated cells) after 24 h of incubation and expressed as percentages of viability. Hinokitiol significantly (p < 0.05) decreased MG-63 cell viability in a dose-dependent manner, with a half-maximal inhibitory concentration (IC₅₀) of 40 µg/mL (Figure 2)

Morphological study of the effects of hinokitiol on osteosarcoma (MG63) cells

A decrease in the cell population was observed following hinokitiol incubation. As depicted in (Figure 3) treatment with the IC₅₀dose of 40 µg/mL hinokitiol led to noticeable cellular shrinkage and a reduction in cell density, causing overall morphological alterations. MG-63 cells were treated with the test compound hinokitiol (IC₅₀40 µg/mL) along with the control group for 24 h. The images were obtained at a magnification (x 10) using an inverted phase-contrast microscope.

Hinokitiol decreases wound closure in MG-63 cells

At an IC₅₀of 40 g/ml, hinokitiol greatly reduced MG-63 cell motility in the wound-healing experiment, a common method for assessing cell migration and cell-cell contact. Hinokitiol virtually completely prevented MG63 cell migration after 24 hours of incubation (Figure 4).

Gene expression profiles of hinokitiol-induced genes

Hinokitiol treatment modulates apoptosis marker gene expression in MG-63 cells. To identify the mechanism of apoptosis caused by treatment with hinokitiol in osteosarcoma cell lines (MG-63), an messenger ribonucleic acid (mRNA) expression study of three genes mainly considered for their involvement in apoptotic pathway regulation, such as BAX, BCL-2, and GSK3β were studied. Hinokitiol treatment significantly (p < 0.05) decreased the expression of BCL-2, an apoptosis inhibitor in cells, and GSK3β, a kinase, compared with untreated cells. Additionally, a significant (p < 0.05) up regulation of BAX gene expression and downregulation of BCL-2 and GSK3β were observed in the hinokitiol-treated group compared to the control group (Figures 5, 6).

Docking study

Molecular modeling is an application in which molecular docking techniques are used to study how receptors interact with ligands. The Autodock 4.2 suite was used to visualize the binding affinities of the hinokitiol against target protein GSK3β (PDB CODE: 2O5K) based on binding energy to elucidate the probable mechanisms of the compounds. The best docking complex was obtained from 100 different conformers for further research based on the extent of hydrogen bonding, maximal occupancy of the binding pocket with the lowest binding energy, and other potential non-covalent interactions. The lowest binding energy (-5.69 kcal/mol) was observed among 100 conformers.

The amino acids of isoleucine 62, alanine 83, aspartic acid (ASP) 133, tyrosine (TYR) 134, valine (VAL) 135, proline (PRO) 136, TYR 140, arginine (ARG) 141, Glycine 185, asparagine ASN 186, LEU 188, ASP 200, and ARG 220 were noted as active site residues in the binding cavities of GSK3β via discovery studio visualizer. Interestingly, the current docking investigation demonstrated that hinokitiol interacts with the amino acids ARG 113, TYR 134, LEU 81, VAL 135, and LYS 197 via hydrogen bonds and hydrophobic interactions within the binding cavity. Hinokitiol formed three strong hydrogen bonds between the hydroxyl and carbonyl groups of the ligand with the side chains of ARG 113, TYR 134, and LEU 81 (Figure 7B). The bond distances of 2.9 Å, 2.1 Å, and 1.7 Å were noted respectively. The one carbon-hydrogen bond was found in ASP 133. It was also observed to involve three alkyl hydrophobic interactions within the amino acids of VAL 135 and LYS 197. Furthermore, the following amino acids were involved in the van der Waals interactions: PRO 136, ASP 190, VAL 82, and GLU 80 (Figure 7).

DISCUSSION

In this investigation, we examined the anticarcinogenic effects of hinokitiol on human osteosarcoma MG-63 cells, which were not previously reported. Due to their well-known lack of functioning p53 (p53 null status), MG-63 cells are excellent models for the development of innovative therapeutic therapies for patients with osteosarcoma.²³

The MTT assay relies on living cells converting MTT into formazan crystals to detect mitochondrial activity, which is a typical method for assessing the metabolic activity of viable cells.¹⁹ This method is universally used to assess the in vitro cytotoxic nature of drugs and chemicals in cell lines because the overall mitochondrial activity of the majority of cell populations is correlated with the ratio of viable cells.¹⁹ In the study, we found a dose-dependent decrease in the percentage of viable MG-63 cells as we increased the concentration of hinokitiol; however, we have selected a hinokitiol (IC₅₀) dose of 40 µM for further research. Morphological analysis of the MG-63 cells was done following exposure to the hinokitiol in the osteosarcoma cell line using an inverted phase-contrast microscope. The findings demonstrated that compared with untreated cells, hinokitiol-treated cells underwent considerable morphological alterations characterized by decreased cell density and cell shrinkage, which is a common feature of apoptotic cells. The scratch-wound healing assay examines the capability of cells to drift and consequently heal the wound created in a confluent plate of cells. Cell migration can be easily measured using the scratch test because the metastatic process is a major contributor to cancer patient deaths.²⁴ Cancer cells propagate and proliferate throughout the body. They traverse through the extracellular matrix, enter the circulation, attach to an unrelated location, and then extravasate to produce far-off foci.²⁴ Hinokitiol 40 µM treatment significantly reduced cell movement in the osteosarcoma migration assay. The results of our study were consistent with tomentosin-induced toxicity on MG-63 cell lines.²³The efficacy of cancer medication therapy depends on its capacity to cause cancer cells to undergo programmed cell death. According to previous studies, there are two primary apoptotic pathways: intrinsic or mitochondrial pathway and extrinsic pathway.²⁵ Most cancer drugs follow the mitochondrial pathway, and in the current study of cell viability, we observed that hinokitiol reduced mitochondrial activity. In the mitochondrial pathway, the process of apoptosis starts with the generation of intracellular impulses that eventually result in the opening of the inner membranes of mitochondria and the gradual release of pro-apoptotic proteins into the cytoplasm.²⁵ Changes in mitochondria are controlled by B-cell lymphoma protein 2 (BCL-2) and (BAX) proteins. BAX protein promotes apoptosis by releasing cytochrome C from the mitochondria. This facilitates subsequent activation of caspases, which eventually results in cell death.²⁵ According to theory, BCL-2 limits the activation of the apoptotic machinery downstream by preventing BAX from releasing cytochrome C. Consequently, cells survive, although BCL-2 is also engaged in relocating proliferating cells back to the resting phase of the cell cycle.²⁶ Thus, the impact of hinokitiol on the apoptosis-related genes BAX and BCL-2 was evaluated. BAX genes are crucial for controlling apoptosis. In the present study, hinokitiol treatment reduced the expression of BCL-2, an apoptosis inhibitor. Significantly higher BAX gene (proapoptotic) expression was observed in the hinokitiol-treated group.

GSK3β is a protein that is highly relevant in different cancers because it plays a significant role in cell growth, proliferation, and migration.^5-7 The serine/threonine protein kinase GSK3β has emerged as a crucial enzyme in controllinof several crucial cellular signaling pathways by phosphorylating its substrates. Phosphorylating many oncogene proteins, such as β-catenin, carcinogenic transcription factors, and c-Myc, causes their ubiquitin degradation and inactivation.²⁷ GSK3β adversely affects cell survival and proliferation in normal physiological settings. GSK3β is therefore commonly thought of as a “tumor-suppressor gene”. According to Tang et al.,¹¹ osteosarcoma cells that overexpress GSK3β have a considerable positive impact on colony growth and tumor growth. Importantly, the findings showed that osteosarcoma tumors were aided in growth by the aberrant activation of GSK3β. According to Cai et al.,²⁸ therapy with a GSK3β inhibitor reduces cell survival and proliferation rates, suggesting that GSK3β may be linked to the development of osteosarcoma. In the current study, we evaluated the role of hinokitiol on GSK3β by in silico models, and the results revealed a significant binding interaction. The GSK3β gene expression analysis also showed hinokitiol’s potential to negatively regulate its function, thereby promoting cell death and mitigating cell survival. A downregulated GSK3β in osteosarcoma has reduced tumor cell viability and triggered apoptosis, according to recent researches. The results of our study were further substantiated by earlier findings that hinokitiol has an apoptotic and anti-hepatofibrotic impact on hepatic stellate cells via activating GSK3β and inhibiting the Wnt/-catenin pathway.²⁹

CONCLUSION

We used a potent bioactive agent known to have anti-proliferative activity in various cell lines. In the current study, we evaluated the anti-proliferative activity of hinokitiol against the osteosarcoma cell line showed significant cytotoxic activity. A deep examination of the cell line after treatment with hinokitiol revealed morphological changes such as cell shrinkage and reduced cell density. In vitro evaluation of the wound healing assay revealed anti-migratory effects, which are characteristic properties of anti-cancer drugs. The study also analyzed mRNA gene expression by RT-PCR in the MG-63 cell line, and the pro-apoptotic BAX gene was upregulated and the anti-apoptotic gene BCL-2 and GSK3β was downregulated. The study also used in silico models to assess the binding energy of the biomarker enzyme GSK3β regulated on numerous signaling pathways for cancer progression hinokitiol, and showed effective interactions at various binding sites of GSK3β. Because the present study was carried out only in the osteosarcoma MG-63 cell line, further research on other osteosarcoma cell lines will substantiate the claim of hinokitiol as a strong candidate drug for ameliorating bone cancer.

Acknowledgement

We, authors, are deeply grateful to Saveetha College of Pharmacy, SIMATS, for providing test facilities to carry out the study.

Ethics

Ethics Committee Approval: There is no ethical problem related to the study.

Informed Consent: This study does not involve human participants or animal subjects requiring consent.

Authorship Contributions

Concept: B.V.C., Design: B.V.C., Data Collection or Processing: P.S, G.J., Analysis or Interpretation: K.K.K, P.B.S, Literature Search: A.K.S, A.R., Writing: P.S., G.J., K.E.

Conflict of Interest: The authors have no conflicts of interest to declare.

Financial Disclosure: The authors declared that this study received no financial support.

References

Isakoff MS, Bielack SS, Meltzer P, Gorlick R. Osteosarcoma: current treatment and a collaborative pathway to success. J Clin Oncol.2015;33:3029-3035.

Kansara M, Teng MW, Smyth MJ, Thomas DM. Translational biology of osteosarcoma. Nat Rev Cancer. 2014;14:722-735.

Broder H, Gottlieb RA, Lepor NE. Chemotherapy and cardiotoxicity. Rev Cardiovasc Med. 2008;9:75-83.

Czekanska EM, Stoddart MJ, Richards RG, Hayes JS. In search of an osteoblast cell model forin vitro research. Eur Cells Mater. 2012;24:1-17.

Embi N, Rylatt DB, Cohen P. Glycogen synthase kinase-3 from rabbit skeletal muscle. Separation from cyclic-AMP-dependent protein kinase and phosphorylase kinase. Eur J Biochem. 2005;107:519-527.

Tejeda-Muñoz N, Robles-Flores M. Glycogen synthase kinase 3 in Wnt signaling pathway and cancer. IUBMB Life. 2015;67:914-922.

Holmes T, O’Brien TA, Knight R, Lindeman R, Symonds G, Dolnikov A. The role of glycogen synthase kinase-3beta in normal hematopoiesis, angiogenesis and leukaemia. Curr Med Chem. 2008;15:1493-1499.

Luo J. Glycogen synthase kinase 3beta (GSK3beta) in tumorigenesis and cancer chemotherapy. Cancer Lett. 2009;273:194-200.

Domoto T, Pyko IV, Furuta T, Miyashita K, Uehara M, Shimasaki T, Nakada M, Minamoto T. Glycogen synthase kinase-3β is a pivotal mediator of cancer invasion and resistance to therapy. Cancer Sci. 2016;107:1363-1372.

Mai W, Miyashita K, Shakoori A, Zhang B, Yu ZW, Takahashi Y, Motoo Y, Kawakami K, Minamoto T. Detection of active fraction of glycogen synthase kinase 3beta in cancer cells by nonradioisotopicin vitro kinase assay. Oncology. 2006;71:297-305.

Tang QL, Xie XB, Wang J, Chen Q, Han AJ, Zou CY, Yin JQ, Liu DW, Liang Y, Zhao ZQ, Yong BC, Zhang RH, Feng QS, Deng WG, Zhu XF, Zhou BP, Zeng YX, Shen JN, Kang T. Glycogen synthase kinase-3β, NF-κB signaling, and tumorigenesis of human osteosarcoma. J Natl Cancer Inst. 2012;104:749-763.

Koufaki M, Theodorou E, Alexi X, Nikoloudaki F, Alexis MN. Synthesis of tropolone derivatives and evaluation of theirin vitro neuroprotective activity. Eur J Med Chem. 2010;45:1107-1112.

Yoshimori A, Oyama T, Takahashi S, Abe H, Kamiya T, Abe T, Tanuma S. Structure-activity relationships of the thujaplicins for inhibition of human tyrosinase. Bioorg Med Chem. 2014;22:6193-6200.

Chiu KC, Shih YH, Wang TH, Lan WC, Li PJ, Jhuang HS, Hsia SM, Shen YW, Yuan-Chien Chen M, Shieh TM.Invitro antimicrobial and antipro-inflammation potential of honokiol and magnolol against oral pathogens and macrophages. J Formos Med Assoc. 2021;120:827-837.

Zhang G, He J, Ye X, Zhu J, Hu X, Shen M, Ma Y, Mao Z, Song H, Chen F. β-Thujaplicin induces autophagic cell death, apoptosis, and cell cycle arrest through ROS-mediated Akt and p38/ERK MAPK signaling in human hepatocellular carcinoma. Cell Death Dis. 2019;10:255.

Li LH, Wu P, Lee JY, Li PR, Hsieh WY, Ho CC, Ho CL, Chen WJ, Wang CC, Yen MY, Yang SM, Chen HW. Hinokitiol induces DNA damage and autophagy followed by cell cycle arrest and senescence in gefitinib-resistant lung adenocarcinoma cells. PLoS One. 2014;9:e104203.

Huang CH, Lu SH, Chang CC, Thomas PA, Jayakumar T, Sheu JR. Hinokitiol, a tropolone derivative, inhibits mouse melanoma (B16-F10) cell migration andin vivo tumor formation. Eur J Pharmacol. 2015;746:148-157.

Wang WK, Lin ST, Chang WW, Liu LW, Li TY, Kuo CY, Hsieh JL, Lee CH. Hinokitiol induces autophagy in murine breast and colorectal cancer cells. Environ Toxicol. 2016;31:77-84.

van Meerloo J, Kaspers GJ, Cloos J. Cell sensitivity assays: the MTT assay. Methods Mol Biol. 2011;731:237-245.

Felice F, Zambito Y, Belardinelli E, Fabiano A, Santoni T, Di Stefano R. Effect of different chitosan derivatives onin vitro scratch wound assay: a comparative study. Int J Biol Macromol.;76:236-241.

Huang KJ, Kuo CH, Chen SH, Lin CY, Lee YR. Honokiol inhibitsin vitro and in vivo growth of oral squamous cell carcinoma through induction of apoptosis, cell cycle arrest and autophagy. J Cell Mol Med. 2018;22:1894-1908.

Morrison TB, Weis JJ, Wittwer CT. Quantification of low-copy transcripts by continuous SYBR Green I monitoring during amplification. Biotechniques. 1998;24:954-958.

Lee CM, Lee J, Nam MJ, Choi YS, Park SH. Tomentosin displays anti-carcinogenic effect in human osteosarcoma MG-63 cellsvia the induction of intracellular reactive oxygen species. Int J Mol Sci.2019;20:1508.

Sundaram GM, Quah S, Sampath P. Cancer: the dark side of wound healing. FEBS J. 2018;285:4516-4534.

Jürgensmeier JM, Xie Z, Deveraux Q, Ellerby L, Bredesen D, Reed JC. Bax directly induces release of cytochrome c from isolated mitochondria. Proc Natl Acad Sci U S A. 1998;95:4997-5002.

Hardwick JM, Soane L. Multiple functions of BCL-2 family proteins. Cold Spring Harb Perspect Biol. 2013;5:a008722.

Dang CV. MYC on the path to cancer. Cell. 2012;149:22-35.

Cai X, Li M, Vrana J, Schaller MD. Glycogen synthase kinase 3- and extracellular signal-regulated kinase-dependent phosphorylation of paxillin regulates cytoskeletal rearrangement. Mol Cell Biol.;26:2857-2868.

Lee IH, Im E, Lee HJ, Sim DY, Lee JH, Jung JH, Park JE, Shim BS, Kim SH. Apoptotic and antihepatofibrotic effect of honokiolvia activation of GSK3β and suppression of Wnt/β-catenin pathway in hepatic stellate cells. Phytother Res. 2021;35:452-462.

In silico and in vitro Evaluation of the Cytotoxic Potential of Hinokitiol against Osteosarcoma by Targeting Glycogen Synthase Kinase 3β